Contents
Why are de Bruijn graphs useful for genome assembly?
Finding an Eulerian cycle allows one to reconstruct the genome by forming an alignment in which each successive k-mer (from successive edges) is shifted by one position. This generates the same cyclic genome sequence without the computational strain of finding a Hamiltonian cycle.
What is a de Bruijn graph and what is it used for?
In bioinformatics, De Bruijn graphs are used for de novo assembly of sequencing reads into a genome.
How do you make a de Bruijn graph?
A de Bruijn graph can be constructed for any sequence, short or long. The first step is to choose a k-mer size, and split the original sequence into its k-mer components. Then a directed graph is constructed by connecting pairs of k-mers with overlaps between the first k-1 nucleotides and the last k-1 nucleotides.
What is node in de Bruijn graph?
In a de Bruijn graph, the nodes represent the distinct k-mers that occur in the reads and there exists an edge between the two nodes if there is a (k–1)-length overlap between the suffix and prefix of the corresponding k-mers, respectively.
Why do bubbles occur in a de Bruijn graph?
A bubble is also formed when an error occurs during the sequence reading process; however, wherever the error happens, there is a path for the k-mer reads to reconnect with the main graph and continue as though nothing had ever happened.
What is K Mer analysis?
In bioinformatics, k-mers are substrings of length contained within a biological sequence. Primarily used within the context of computational genomics and sequence analysis, in which k-mers are composed of nucleotides (i.e.
How do you pronounce de Bruijn?
The word “bruijn” essentially means the colour brown – although modern spelling would be “bruin”. Here are the various ways I have heard it pronounced, some of them in successive talks at ISMB 2013 in the same session even: broon. broo-en, brewin’
How do you find the Eulerian path?
Euler paths are an optimal path through a graph. They are named after him because it was Euler who first defined them. By counting the number of vertices of a graph, and their degree we can determine whether a graph has an Euler path or circuit.
What does 30x coverage mean?
The higher the coverage, the better the data quality. The number before the ‘x’ is the coverage (the average number of times your genome will be sequenced). For example, when you get 30x WGS, the ’30x’ means that your entire genome will be sequenced an average of 30 times.
What does contig mean?
A contig–from the word “contiguous”–is a series of overlapping DNA sequences used to make a physical map that reconstructs the original DNA sequence of a chromosome or a region of a chromosome. A contig can also refer to one of the DNA sequences used in making such a map.
What is the most frequent 3 Mer?
You can see that ACTAT is a most frequent 5-mer of ACAACTATGCATACTATCGGGAACTATCCT, and ATA is a most frequent 3-mer of CGATATATCCATAG.